Review



pgfp v rs vectors 560  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    OriGene pgfp v rs vectors 560
    Pgfp V Rs Vectors 560, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+plasmid+vector/HNF+4+alpha+(HNF4A)+Human+shRNA+Plasmid+Kit/10__1016_slash_j__omton__2026__201246-249-16-20
    Average 94 stars, based on 1 article reviews
    pgfp v rs vectors 560 - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Increased SUMO-2/3-ylation mediated by SENP3 degradation is protective against cadmium-induced caspase 3-dependent cytotoxicity.
    Article Snippet: .. SENP3 was knocked down in PC12 cells by transient transfection with an shRNA plasmid vector based on HuSH-29 pGFP-V-RS system (Origene Technologies, Inc., Rockville, MD, USA), containing the following sequences: shRNA1: TGTGGACATCTTCAATAAGGAACTATTGC; shRNA2: TATGGACA- GAACTGGCTCAATGACCAGGT; shRNA3: CTTGTCTCAGTTGATGTAAGGCGACGCAC; shRNA4: ACTGGCTCAATGACCAGGTGATGAACATG. ..

    shRNA:

    Article Title: Increased SUMO-2/3-ylation mediated by SENP3 degradation is protective against cadmium-induced caspase 3-dependent cytotoxicity.
    Article Snippet: .. SENP3 was knocked down in PC12 cells by transient transfection with an shRNA plasmid vector based on HuSH-29 pGFP-V-RS system (Origene Technologies, Inc., Rockville, MD, USA), containing the following sequences: shRNA1: TGTGGACATCTTCAATAAGGAACTATTGC; shRNA2: TATGGACA- GAACTGGCTCAATGACCAGGT; shRNA3: CTTGTCTCAGTTGATGTAAGGCGACGCAC; shRNA4: ACTGGCTCAATGACCAGGTGATGAACATG. ..

    Article Title: Depletion of Mageb16 induces differentiation of pluripotent stem cells predominantly into mesodermal derivatives
    Article Snippet: .. Four sets of shRNA Plasmid vector (pGFP-V-RS_HuSH TM Origene) targeting Mageb16 are used. .. These plasmids are retroviral silencing plasmids of Origene (Rockville, MD, USA) with GFP plus screening for transfection efficiency and puromycin resistance for stable polyclonal cell line generation.

    Article Title: Oncomorphic TP 53 Mutations in Gynecologic Cancers Lose the Normal Protein:Protein Interactions with the microRNA Microprocessing Complex
    Article Snippet: .. WT p53 was knocked down using a shRNA plasmid vector or scrambled control (Origene). ..

    Plasmid Preparation:

    Article Title: Increased SUMO-2/3-ylation mediated by SENP3 degradation is protective against cadmium-induced caspase 3-dependent cytotoxicity.
    Article Snippet: .. SENP3 was knocked down in PC12 cells by transient transfection with an shRNA plasmid vector based on HuSH-29 pGFP-V-RS system (Origene Technologies, Inc., Rockville, MD, USA), containing the following sequences: shRNA1: TGTGGACATCTTCAATAAGGAACTATTGC; shRNA2: TATGGACA- GAACTGGCTCAATGACCAGGT; shRNA3: CTTGTCTCAGTTGATGTAAGGCGACGCAC; shRNA4: ACTGGCTCAATGACCAGGTGATGAACATG. ..

    Article Title: Depletion of Mageb16 induces differentiation of pluripotent stem cells predominantly into mesodermal derivatives
    Article Snippet: .. Four sets of shRNA Plasmid vector (pGFP-V-RS_HuSH TM Origene) targeting Mageb16 are used. .. These plasmids are retroviral silencing plasmids of Origene (Rockville, MD, USA) with GFP plus screening for transfection efficiency and puromycin resistance for stable polyclonal cell line generation.

    Article Title: Oncomorphic TP 53 Mutations in Gynecologic Cancers Lose the Normal Protein:Protein Interactions with the microRNA Microprocessing Complex
    Article Snippet: .. WT p53 was knocked down using a shRNA plasmid vector or scrambled control (Origene). ..

    Control:

    Article Title: Oncomorphic TP 53 Mutations in Gynecologic Cancers Lose the Normal Protein:Protein Interactions with the microRNA Microprocessing Complex
    Article Snippet: .. WT p53 was knocked down using a shRNA plasmid vector or scrambled control (Origene). ..



    Similar Products

    94
    OriGene pgfp v rs vectors 560
    Pgfp V Rs Vectors 560, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+plasmid+vector/HNF+4+alpha+(HNF4A)+Human+shRNA+Plasmid+Kit/10__1016_slash_j__omton__2026__201246-249-16-20
    Average 94 stars, based on 1 article reviews
    pgfp v rs vectors 560 - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    96
    Addgene inc scramble vector
    Scramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+plasmid+vector/scramble+shRNA+(Plasmid+%231864)/pm41819223-263-1-3
    Average 96 stars, based on 1 article reviews
    scramble vector - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    90
    OriGene dkk3 shrna expressing vector
    Dkk3 Shrna Expressing Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+plasmid+vector/DKK3+Human+shRNA+Plasmid+Kit/10__1016_slash_j__job__2026__100769-101-6-10
    Average 90 stars, based on 1 article reviews
    dkk3 shrna expressing vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    94
    Addgene inc psih1puro vector
    Psih1puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+plasmid+vector/pSIH1-puro-control+shRNA+(Plasmid+%2326597)/pm41735312-295-1-4
    Average 94 stars, based on 1 article reviews
    psih1puro vector - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    Addgene inc psih1 puro vector
    Psih1 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+plasmid+vector/pSIH1-puro-control+shRNA+(Plasmid+%2326597)/pmc13043670-345-1-4
    Average 94 stars, based on 1 article reviews
    psih1 puro vector - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    98
    Addgene inc shrna lentivirus vector
    a Enrichment of EMT and NE gene signatures following EIF6 knockdown in non-NE cell states. RNA-seq analysis is performed in n = 2 biologically independent samples. b Gene expression profiling of EMT- and NE-associated pathways upon EIF6 knockdown in non-NE cell states. RNA-seq analysis is performed in n = 2 biologically independent samples. c Immunoblot analysis of EMT-associated and NE proteins following EIF6 knockdown across multiple SCLC models. Blots are representative of n = 3 biologically independent experiments. For H69M, the samples derive from the same experiment but different gels for ZEB1, another for ZEB2, another for MYCN, another for YAP1, another for eIF6 and c-Myc, another for ASCL1, NEUROD1 and β-tubulin were processed in parallel; For H82R, the samples derive from the same experiment but different gels for ZEB2, ZEB1, MYCN and c-Myc, another for YAP1 and ASCL1, another for NEUROD1, eIF6 and β-tubulin were processed in parallel. For H209A, the samples derive from the same experiment, but different gels for ZEB2, ZEB1, MYCN and c-Myc, another for YAP1 and ASCL1, another for eIF6, another for NEUROD1 and β-tubulin were processed in parallel. d H69 cells with EIF6 knockdown were treated with HGF (40 ng mL⁻¹) for two weeks. Bright-field images show adherent growth (top). Attached colonies were stained with crystal violet for quantification ( n = 3 biologically independent experiments). Scale bar, 100 μm. Error bars represent s.d. Statistical significance was assessed using a two-sided unpaired Wilcoxon rank-sum test. e Re-expression of <t>shRNA-resistant</t> wild-type EIF6 using pCDH <t>lentivirus</t> restores HGF-induced cell attachment in EIF6 knockdown cells. Top: immunoblot showing EIF6 knockdown and re-expression efficiency. Bottom, quantification of crystal violet–stained colonies ( n = 4 independent experiments). Error bars represent s.d. Statistical significance was assessed using a two-sided unpaired Wilcoxon rank-sum test. f Representative images of H69 cells with EIF6 knockdown and re-expression after HGF treatment (40 ng mL⁻¹) for three weeks. Bright-field images (left) and crystal violet–stained colonies (right) are shown. Scale bar, 20 μm. g Live/dead cell analysis of shNTC and shEIF6 H69M cells treated with or without EP (carboplatin 10 μM and etoposide 2 μM) for 72 h, measured by flow cytometry. Data are mean ± SEM from n = 3 independent experiments. Statistical significance was determined using a two-sided unpaired Wilcoxon rank-sum test. h Chemotherapy sensitivity of subcutaneous xenografts derived from shNTC or shEIF6 H69 cells. Tumour volume changes were assessed after three chemotherapy cycles ( n = 13 tumours per group). Response categories were defined as CR (−100%), PR (−30% to 0%) and PD (>20%). Lowercase letters indicate tumours used for immunohistochemistry in i . Created in BioRender. Shen, S. (2026) https://BioRender.com/5p1ea8h . i Representative immunohistochemistry images of ASCL1, NEUROD1, POU2F3, YAP1 and EIF6 in corresponding tumours from h . Scale bars, 50 μm.
    Shrna Lentivirus Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+plasmid+vector/psPAX2+(Plasmid+%2312260)/pmc12946193-514-7-15
    Average 98 stars, based on 1 article reviews
    shrna lentivirus vector - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    96
    Addgene inc shscramble vector
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Shscramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+plasmid+vector/scramble+shRNA+(Plasmid+%231864)/pmc12828543-406-4-8
    Average 96 stars, based on 1 article reviews
    shscramble vector - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 scramble vector
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Plko 1 Scramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+plasmid+vector/scramble+shRNA+(Plasmid+%231864)/pm41702885-72-1-4
    Average 96 stars, based on 1 article reviews
    plko 1 scramble vector - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results


    a Enrichment of EMT and NE gene signatures following EIF6 knockdown in non-NE cell states. RNA-seq analysis is performed in n = 2 biologically independent samples. b Gene expression profiling of EMT- and NE-associated pathways upon EIF6 knockdown in non-NE cell states. RNA-seq analysis is performed in n = 2 biologically independent samples. c Immunoblot analysis of EMT-associated and NE proteins following EIF6 knockdown across multiple SCLC models. Blots are representative of n = 3 biologically independent experiments. For H69M, the samples derive from the same experiment but different gels for ZEB1, another for ZEB2, another for MYCN, another for YAP1, another for eIF6 and c-Myc, another for ASCL1, NEUROD1 and β-tubulin were processed in parallel; For H82R, the samples derive from the same experiment but different gels for ZEB2, ZEB1, MYCN and c-Myc, another for YAP1 and ASCL1, another for NEUROD1, eIF6 and β-tubulin were processed in parallel. For H209A, the samples derive from the same experiment, but different gels for ZEB2, ZEB1, MYCN and c-Myc, another for YAP1 and ASCL1, another for eIF6, another for NEUROD1 and β-tubulin were processed in parallel. d H69 cells with EIF6 knockdown were treated with HGF (40 ng mL⁻¹) for two weeks. Bright-field images show adherent growth (top). Attached colonies were stained with crystal violet for quantification ( n = 3 biologically independent experiments). Scale bar, 100 μm. Error bars represent s.d. Statistical significance was assessed using a two-sided unpaired Wilcoxon rank-sum test. e Re-expression of shRNA-resistant wild-type EIF6 using pCDH lentivirus restores HGF-induced cell attachment in EIF6 knockdown cells. Top: immunoblot showing EIF6 knockdown and re-expression efficiency. Bottom, quantification of crystal violet–stained colonies ( n = 4 independent experiments). Error bars represent s.d. Statistical significance was assessed using a two-sided unpaired Wilcoxon rank-sum test. f Representative images of H69 cells with EIF6 knockdown and re-expression after HGF treatment (40 ng mL⁻¹) for three weeks. Bright-field images (left) and crystal violet–stained colonies (right) are shown. Scale bar, 20 μm. g Live/dead cell analysis of shNTC and shEIF6 H69M cells treated with or without EP (carboplatin 10 μM and etoposide 2 μM) for 72 h, measured by flow cytometry. Data are mean ± SEM from n = 3 independent experiments. Statistical significance was determined using a two-sided unpaired Wilcoxon rank-sum test. h Chemotherapy sensitivity of subcutaneous xenografts derived from shNTC or shEIF6 H69 cells. Tumour volume changes were assessed after three chemotherapy cycles ( n = 13 tumours per group). Response categories were defined as CR (−100%), PR (−30% to 0%) and PD (>20%). Lowercase letters indicate tumours used for immunohistochemistry in i . Created in BioRender. Shen, S. (2026) https://BioRender.com/5p1ea8h . i Representative immunohistochemistry images of ASCL1, NEUROD1, POU2F3, YAP1 and EIF6 in corresponding tumours from h . Scale bars, 50 μm.

    Journal: Nature Communications

    Article Title: Eukaryote initiation factor 6 modulates small-cell lung carcinoma plasticity via the integrin-FAK signaling axis

    doi: 10.1038/s41467-026-69899-8

    Figure Lengend Snippet: a Enrichment of EMT and NE gene signatures following EIF6 knockdown in non-NE cell states. RNA-seq analysis is performed in n = 2 biologically independent samples. b Gene expression profiling of EMT- and NE-associated pathways upon EIF6 knockdown in non-NE cell states. RNA-seq analysis is performed in n = 2 biologically independent samples. c Immunoblot analysis of EMT-associated and NE proteins following EIF6 knockdown across multiple SCLC models. Blots are representative of n = 3 biologically independent experiments. For H69M, the samples derive from the same experiment but different gels for ZEB1, another for ZEB2, another for MYCN, another for YAP1, another for eIF6 and c-Myc, another for ASCL1, NEUROD1 and β-tubulin were processed in parallel; For H82R, the samples derive from the same experiment but different gels for ZEB2, ZEB1, MYCN and c-Myc, another for YAP1 and ASCL1, another for NEUROD1, eIF6 and β-tubulin were processed in parallel. For H209A, the samples derive from the same experiment, but different gels for ZEB2, ZEB1, MYCN and c-Myc, another for YAP1 and ASCL1, another for eIF6, another for NEUROD1 and β-tubulin were processed in parallel. d H69 cells with EIF6 knockdown were treated with HGF (40 ng mL⁻¹) for two weeks. Bright-field images show adherent growth (top). Attached colonies were stained with crystal violet for quantification ( n = 3 biologically independent experiments). Scale bar, 100 μm. Error bars represent s.d. Statistical significance was assessed using a two-sided unpaired Wilcoxon rank-sum test. e Re-expression of shRNA-resistant wild-type EIF6 using pCDH lentivirus restores HGF-induced cell attachment in EIF6 knockdown cells. Top: immunoblot showing EIF6 knockdown and re-expression efficiency. Bottom, quantification of crystal violet–stained colonies ( n = 4 independent experiments). Error bars represent s.d. Statistical significance was assessed using a two-sided unpaired Wilcoxon rank-sum test. f Representative images of H69 cells with EIF6 knockdown and re-expression after HGF treatment (40 ng mL⁻¹) for three weeks. Bright-field images (left) and crystal violet–stained colonies (right) are shown. Scale bar, 20 μm. g Live/dead cell analysis of shNTC and shEIF6 H69M cells treated with or without EP (carboplatin 10 μM and etoposide 2 μM) for 72 h, measured by flow cytometry. Data are mean ± SEM from n = 3 independent experiments. Statistical significance was determined using a two-sided unpaired Wilcoxon rank-sum test. h Chemotherapy sensitivity of subcutaneous xenografts derived from shNTC or shEIF6 H69 cells. Tumour volume changes were assessed after three chemotherapy cycles ( n = 13 tumours per group). Response categories were defined as CR (−100%), PR (−30% to 0%) and PD (>20%). Lowercase letters indicate tumours used for immunohistochemistry in i . Created in BioRender. Shen, S. (2026) https://BioRender.com/5p1ea8h . i Representative immunohistochemistry images of ASCL1, NEUROD1, POU2F3, YAP1 and EIF6 in corresponding tumours from h . Scale bars, 50 μm.

    Article Snippet: Lentiviruses were made by co-transfection of the shRNA lentivirus vector and the packaging plasmid psPAX2 (addgene#12260) and pMD2.G (addgene#12259) through calcium phosphate co-precipitation into 293 T cells.

    Techniques: Knockdown, RNA Sequencing, Gene Expression, Western Blot, Staining, Expressing, shRNA, Cell Attachment Assay, Cell Analysis, Flow Cytometry, Derivative Assay, Immunohistochemistry

    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Journal: iScience

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma

    doi: 10.1016/j.isci.2025.114564

    Figure Lengend Snippet: In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Article Snippet: LFS_primary cells transduced with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative control.

    Techniques: In Vivo, Biomarker Discovery, Injection, Derivative Assay, Control, Expressing, shRNA